| 產(chǎn)品名稱 |
pS356 |
| 商品貨號 |
B213266 |
| Designations |
pS356 |
| Depositors |
Chiron Corp., MS Richman, Chiron Corp. |
| U.S. Patent |
|
| Disclosure |
This material is cited in a US or other Patent and may not be used to
infringe the claims. Depending on the wishes of the Depositor, ATCC may be
required to inform the Patent Depositor of the party to which the material was
furnished. This material may not have been produced or characterized by ATCC. |
| Biosafety Level |
1 |
| Vector Information |
Size (kb): 5.8000001907348630 Vector: pS356 (plasmid) Promoters: Promoter GAPDH Construction: pYASI1 Marker(s):LEU2,ampR Construct size (kb): 5.800000190734863 Features: marker(s): LEU2
marker(s): ampR
promoter: GAPDH
regulator: ADH2
replicon: 2 micron
replicon: pMB1
transcription terminator: GAPDH
coding sequence: SOD |
| Applications |
YX-type (expression) shuttle vector vector permitting construction of fusion proteins |
| Comments |
Restriction digests of the clone give the following sizes (kb): EcoRI--5.8; BamHI--3.7, 2.1; NcoI--5.8. Shuttle expression vector producing fusion proteins with human SOD (after Gln154 of SOD). Expression is regulated by the ADH2 UAS. Constructed from pYASI1 by replacing the met-proinsulin sequence immediately downstream of Gln154 of the human SOD coding sequence with an EcoRI-containing adaptor: 5'AATTTGGGAATTCCATAATTAATTAAG3' /3'ACCCTTAAGGTATTAATTAATTCAGCT5'. |
| Media |
ATCC® Medium 1227: LB Medium (ATCC medium 1065) with 50 mcg/ml ampicillin
|
| Growth Conditions |
Temperature: 37.0°C |
| References |
Houghton M, et al. Hepatitis C virus protease. US Patent 5,371,017 dated Dec 6 1994
Cousens LS, et al. High level expression of proinsulin in the yeast, Saccharomyces cerevisiae. Gene 61: 265-275, 1987. PubMed: 3328732
|
| Shipped |
freeze-dried |
| Shipping Information |
Distributed: freeze-dried |
