產(chǎn)品名稱 | Issatchenkia orientalis Kudrjanzev |
---|---|
商品貨號 | B221771 |
Deposited As | Candida krusei (Castellani) Berkhout |
Strain Designations | [ATCC 749, CBS 573, CCRC 20514, IFO 1064, IFO 1395, JCM 1609, NRRL Y-413, NRRL Y-7179] |
Alternate State | Candida krusei (Castellani) Berkhout |
Application | ATCC® 6258-MINI-PACK™ consists of 6 ready-to-use vials of ATCC® 6258™ frozen in 200 µL of glycerol stock, eliminating the need to rehydrate and culture the strain prior to use. Each vial is provided with a 2-D barcode for easy storage and tracking, as well as peel-off labels for fast and reliable recordkeeping. Learn more about ATCC® Minis![]() ![]() Assay of itraconzaole
Assay of ketoconazole
Quality control
Quality control strain
Sterility testing
Susceptibility disc testing
Susceptibility testing
Quality control strain for API products
Antifungal susceptibility testing Ref ![]() ![]() ![]() ![]() |
Biosafety Level | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
Product Format | frozen 6 ready-to-use vials of ATCC® 6258™ in glycerol stock |
Storage Conditions | -70°C or colder, store upright. Storage at -20°C is acceptable for up to 1 year. |
Type Strain | yes (type strain of Candida krusei) |
Preceptrol® | no |
Comments | Esterase activity
RAPD profiles
This organism is a CLSI control strain for antimicrobial susceptibility testing.The current name of Candida krusei and Issatchenkia orientalis is Pichia kudriavzevii Boidin et al. |
Morphology | After 4 days on Potato dextrose medium at 37°C, colony is white, smooth and soft. Cells are ovoid to cylindrical, single, in pairs or chains, pseudohyphae are absent. |
Medium | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 28: Emmons' modification of Sabouraud's agar ATCC® Medium 1245: YEPD |
Growth Conditions | Temperature: 25°C to 30°C
Atmosphere: Typical aerobic |
Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence. AGGATCATTACTGTGATTTAGTACTACACTGCGTGAGCGGAACGAAAACAACAACACCTAAAATGTGGAATATAGCATATAGTCGACAAGAGAAATCTACGAAAAACAAACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTTTGAGCGTCGTTTCCATCTTGCGCGTGCGCAGAGTTGGGGGAGCGGAGCGGACGACGTGTAAAGAGCGTCGGAGCTGCGACTCGCCTGAAAGGGAGCGAAGCTGGCCGAGCGAACTAGACTTTTTTTCAGGGACGCTTGGCGGCCGAGAGCGAGTGTTGCGAGACAACAAAAAGCTCGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAG D1D2 region of the 26S ribosomal RNA gene. CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAGATTTGAAATCGTGCTTTGCGGCACGAGTTGTAGATTGCAGGTTGGAGTCTGTGTGGAAGGCGGTGTCCAAGTCCCTTGGAACAGGGCGCCCAGGAGGGTGAGAGCCCCGTGGGATGCCGGCGGAAGCAGTGAGGCCCTTCTGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAGCGGGTGGTAAATTCCATCTAAGGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAAGGGAAGGGTATTGCGCCCGACATGGGGATTGCGCACCGCTGCCTCTCGTGGGCGGCGCTCTGGGCTTTCCCTGGGCCAGCATCGGTTCTTGCTGCAGGAGAAGGGGTTCTGGAACGTGGCTCTTCGGAGTGTTATAGCCAGGGCCAGATGCTGCGTGCGGGGACCGAGGACTGCGGCCGTGTAGGTCACGGATGCTGGCAGAACGGCGCAACACCG |
Name of Depositor | A Castellani |
Special Collection | ATCC® Minis |
Isolation | Sputum of patient with bronchomycosis, Sri Lanka |
Cross References | Nucleotide (GenBank) : AX109706 Sequence 439 from Patent WO0123604. Nucleotide (GenBank) : M60305 C. krusei small subunit ribosomal RNA. Nucleotide (GenBank) : S75391 cytochrome P-450 lanosterol-alpha-demethylase [Issatchenkia Nucleotide (GenBank) : AF250036 Issatchenkia orientalis strain ATCC 6258 ABC transporter Abc1p Nucleotide (GenBank) : AF250037 Issatchenkia orientalis strain ATCC 6258 ABC transporter Abc2p Nucleotide (GenBank) : KC601852 ITS including 5.8S rRNA gene Nucleotide (GenBank) : KC601854 D1/D2 region of 28S rRNA gene |
References | Rudek W. Esterase activity in Candida species. J Clin Microbiol 8: 756-759, 1978. PubMed: 370150 Zeng S, et al. Random amplified polymorphic DNA analysis of culture collection strains of Candida species. J Med Vet Mycol 34: 293-297, 1996. PubMed: 8873891 Castellani AJ. Note on the importance of hyphomycetes and other fungi in tropical pathology. Br. Med. J. 2: 1208-1212, 1912. Brenner DJ, et al. Multisite reproducibility of colorimetric broth microdilution method for antifungal susceptibility testing of yeast isolates. J Clin Microbiol 32: 1625-1628, 1994. PubMed: 7929747 Pfaller MA, et al. Selection of candidate quality control isolates and tentative quality control ranges for in vitro susceptibility testing of yeast isolates by National Committee for Clinical Laboratory Standards proposed standard methods. J Clin Microbiol 32: 1650-1653, 1994. PubMed: 7929752 Espinel-Ingroff A, et al. Comparison of two alternative microdilution procedures with the National Committee for Clinical Laboratory Standards reference macrodilution method M27-P for in vitro testing of fluconazole-resistant and -susceptible isolates of Candida albicans. J Clin Microbiol 33: 3154-3158, 1995. PubMed: 8586692 Rex JH, et al. Quality control guidelines for National Committee for Clinical Laboratory Standards--recommended broth macrodilution testing of ketoconazole and itraconazole. J. Clin. Microbiol. 34: 816-817, 1996. PubMed: 8815089 Davey KG, et al. Comparative evaluation of FUNGITEST and broth microdilution methods for antifungal drug susceptibility testing of Candida species and Cryptococcus neoformans. J Clin Microbiol 36: 926-930, 1998. PubMed: 9542910 Sensititre™ YeastOne. Thermo Scientific™ Sensititre™ Systems, Trek Diagnostic Systems. Quality Control MIC Limits for Broth Microdilution Informational Supplement. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M27-S3. Method for Antifungal Disk Diffusion Susceptibility Testing of Yeast; Approved Guideline. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M44-A2. Supplemental assay method for testing growth promoting qualities of fluid thioglycollate medium and soybean-casein digest medium using Bacillus Subtilis spores and Candida krusei as the indicator organisms. :US Department of Agriculture;USDA, Center for Veterinary Biologics STSAM0900.01, 1999 Supplemental assay method for testing growth-promoting qualities of brain heart infusion agar using Bacillus subtilis spores and Candida krusei as indicator organisms. :US Department of Agriculture;USDA, Center for Veterinary Biologics STSAM0902.01, 1999 Supplemental assay method for testing for preservative interference with sterility tests. :US Department of Agriculture;USDA, Center for Veterinary Biologics STSAM0903.01, 1999 VITEK 2 Antifungal AST Card. bioMerieux. Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi: Approved Standard - 2nd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M38-A2. VITEK 2 AST-YS QC Set. bioMerieux. Ghannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006. Tsui CK, et al. Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses. FEMS Yeast Res. 8: 651-659, 2008. PubMed: 18248416 Borman AM, et al. Candida nivariensis, an emerging pathogenic fungus with multidrug resistance to antifungal agents. J. Clin. Microbiol. 46: 933-938, 2008. PubMed: 18199788 Kahn JN, et al. Acquired echinocandin resistance in a Candida krusei isolate due to modification of glucan synthase. Antimicrob. Agents Chemother. 51: 1876-1878, 2007. PubMed: 17325225 Innings A, et al. Multiplex real-time PCR targeting the RNase P RNA gene for detection and identification of Candida species in blood. J Clin Microbiol 45: 874-880, 2007. PubMed: 17215340 Park S, et al. Specific substitutions in the echinocandin target Fks1p account for reduced susceptibility of rare laboratory and clinical Candida sp. isolates. Antimicrob. Agents Chemother. 49: 3264-3273, 2005. PubMed: 16048935 type strain of Candida krusei |
梅經(jīng)理 | 17280875617 | 1438578920 |
胡經(jīng)理 | 13345964880 | 2438244627 |
周經(jīng)理 | 17757487661 | 1296385441 |
于經(jīng)理 | 18067160830 | 2088210172 |
沈經(jīng)理 | 19548299266 | 2662369050 |
李經(jīng)理 | 13626845108 | 972239479 |